Analysis of NOVA2 gene variant in a child with Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for a child with Neurodevelopmental disorder with or without autistic features and/or structural brain abnormalities (NEDASB).@*METHODS@#A child with NEDASB who presented at the Third Affiliated Hospital of Zhengzhou University in July 2021 was selected as the subject. Peripheral blood samples of the child and her parents were collected and subjected to high-throughput sequencing. Candidate variant was verified by Sanger sequencing and bioinformatic analysis.@*RESULTS@#The child was found to harbor a heterozygous c.820_828delinsCTTCA (p.Thr274Leufs*121) variant of the NOVA2 gene, for which both of her parents were of wild type. The variant was predicted as pathogenic based on the guidelines from the American College of Medical Genetics and Genomics.@*CONCLUSION@#The heterozygous c.820_828delinsCTTCA (p.Thr274Leufs*121) variant of the NOVA2 gene probably underlay the disease in this child. Above finding has enriched the spectrum of NOVA2 gene variants and provided a basis for genetic counseling and prenatal diagnosis for this family.

Analysis of ADNP gene variant in a child with Helsmoortel-van der Aa syndrome / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for a child manifesting with intellectual disability, language delay and autism spectrum disorder.@*METHODS@#Genomic DNA was extracted from peripheral blood samples of the child and his family members, and subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and interpreted according to the guidelines of the American College of Medical Genetics and Genomics.@*RESULTS@#The child was found to harbor a heterozygous c.568C>T (p.Q190X) nonsense variant of the ADNP gene, which was not detected in either parent by Sanger sequencing.@*CONCLUSION@#The clinical and genetic testing both suggested that the child has Helsmoortel-van der Aa syndrome due to ADNP gene mutation, which is extremely rare in China.

Effects of CACNA1H gene knockout on autistic-like behaviors and the morphology of hippocampal neurons in mice / 北京大学学报(医学版)

OBJECTIVE@#To investigate the effects of CACNA1H gene knockout (KO) on autistic-like behaviors and the morphology of hippocampal neurons in mice.@*METHODS@#In the study, 25 CACNA1H KO mice of 3-4 weeks old and C57BL/6 background were recruited as the experimental group, and 26 wild type (WT) mice of the same age and background were recruited as the control group. Three-chamber test and open field test were used to observe the social interaction, anxiety, and repetitive behaviors in mice. After that, their brain weight and size were measured, and the number of hippocampal neurons were observed by Nissl staining. Furthermore, the CACNA1H heterozygote mice were interbred with Thy1-GFP-O mice to generate CACNA1H-/--Thy1+(KO-GFP) and CACNA1H+/+-Thy1+ (WT-GFP) mice. The density and maturity of dendritic spines of hippocampal neurons were observed.@*RESULTS@#In the sociability test session of the three-chamber test, the KO mice spent more time in the chamber of the stranger mice than in the object one (F1, 14=95.086, P < 0.05; Post-Hoc: P < 0.05), without any significant difference for the explored preference index between the two groups (t=1.044, P>0.05). However, in the social novelty recognition test session, no difference was observed between the time of the KO mice spend in the chamber of new stranger mice and the stranger one (F1, 14=18.062, P < 0.05; Post-Hoc: P>0.05), and the explored preference index of the KO mice was less than that of the control group (t=2.390, P < 0.05). In the open field test, the KO mice spent less time in the center of the open field apparatus than the control group (t=2.503, P < 0.05), but the self-grooming time was significantly increased compared with the control group (t=-2.299, P < 0.05). Morphological results showed that the brain weight/body weight ratio (t=0.356, P>0.05) and brain size (t=-0.660, P>0.05) of the KO mice were not significantly different from those of the control group, but the number of neurons were significantly reduced in hippocampal dentate gyrus compared with the control group (t=2.323, P < 0.05). Moreover, the density of dendritic spine of dentate gyrus neurons in the KO-GFP mice was significantly increased compared with the control group (t=-2.374, P < 0.05), without any significant difference in spine maturity (t=-1.935, P>0.05).@*CONCLUSION@#CACNA1H KO mice represent autistic-like behavior, which may be related to the decrease in the number of neurons and the increase in the density of dendritic spine in the dentate gyrus.

A case of Bainbridge-Ropers syndrome with autism in conjunct with ASXL3 gene variant and its clinical analysis / 中华医学遗传学杂志

OBJECTIVE@#To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism.@*METHODS@#High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.@*RESULTS@#The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.@*CONCLUSION@#The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.

Clinical features and genetic analysis of three children with mental retardation, language impairment and autistic features due to de novo variants of FOXP1 gene / 中华医学遗传学杂志

OBJECTIVE@#To analyze the clinical features and genetic basis of three children with mental retardation, language impairment and autistic features due to de novo variants of FOXP1 gene.@*METHODS@#Clinical data of the children were collected.Trio-whole exome sequencing was carried out for the children and their parents. Pathogenicity of the variants was analyzed through bioinformatics prediction.@*RESULTS@#All of the children had various degrees of mental retardation in conjunct with language deficit, global developmental delay, abnormal behavior and peculiar facial features, among whom two also developed autism spectrum disorders. The results of genetic testing showed that all three children harbored de novo variants of the FOXP1 gene, namely c.613_c.614delCTinsTA, c.1248delC and c.1393A>G. Two of these were frameshift variants and one was missense variant, which were all rated as pathogenic based on the guidelines of the American College of Medical Genetics (ACMG). Database search suggested that c.613_c.614delCTinsTA and c.1248delC were unreported previously.@*CONCLUSION@#For the three children from unrelated families with mental retardation in conjunct with language deficit, global growth delay, abnormal behavior and peculiar facial features, the c.613_ c. 614delCTinsTA, c.1248delC and c.1393A>G variants of the FOXP1 gene may be the pathogenic factors. Above cases have further expanded the genotype-phenotype profile of FOXP1 deficiency syndrome.

Identification of a novel TBR1 gene variant in a Chinese pedigree affected with intellectual developmental disorder with autism and speech delay / 中华医学遗传学杂志

OBJECTIVE@#To describe a family with intellectual developmental disorder with autism and speech delay (IDDAS) caused by a splice variant of TBR1 gene.@*METHODS@#A pregnant women with mental retardation, who also had a family history of mental retardation, was admitted to Prenatal Diagnosis Center of WanBei Coal and Electricity Group General Hospital Corporation in April 2019. Molecular genetic tests were performed on the pregnant women and ten other family members to analyze the pathogenic genotype. Functional assays of the pathogenic variant was carried out by minigene technology. With the determination of the genotype, prenatal diagnosis was carried out by amniotic fluid sampling.@*RESULTS@#Through whole exome sequencing, a novel splicing variant (c.1129-1G>C) was identified in the TBR1 gene of the proband, which has co-segregated with the disease phenotype in the family. The results of minigene assay showed abnormal splicing of exon 5. The variant was not detected in the fetal amniotic fluid. Fetal growth and development were normal one year after the birth.@*CONCLUSION@#The c.1129-1G>C variant of the TBR1 probably underlay the disease in of the pedigree. Timely prenatal genetic diagnosis and consultation can help to stop the transmission of the pathogenic variant.

Síndrome X frágil: presentación clínica, patología y tratamiento / Fragile X syndrome: clinical presentation, pathology and treatment

Resumen El síndrome X frágil es la condición monogenética que produce más casos de autismo y de discapacidad intelectual. La repetición de tripletes CGG (> 200) y su metilación conllevan el silenciamiento del gen FMR1. La proteína FMRP (producto del gen FMR1) interacciona con los ribosomas, controlando la traducción de mensajeros específicos y su pérdida produce alteraciones de la conectividad sináptica. El tamizaje de síndrome X frágil se realiza por reacción en cadena de la polimerasa. La recomendación actual de la Academia Americana de Pediatría es realizar pruebas a quienes presenten discapacidad intelectual, retraso global del desarrollo o antecedentes familiares de afección por la mutación o premutación. Países hispanos como Colombia, Chile y España reportan altas prevalencias de síndrome X frágil y han creado asociaciones o corporaciones nacionales de X frágil que buscan acercar a los pacientes a redes disponibles de diagnóstico y tratamiento.

Abstract Fragile X syndrome is the monogenetic condition that produces more cases of autism and intellectual disability. The repetition of CGG triplets (> 200) and their methylation entail the silencing of the FMR1 gene. The FMRP protein (product of the FMR1 gene) interacts with ribosomes by controlling the translation of specific messengers, and its loss causes alterations in synaptic connectivity. Screening for fragile X syndrome is performed by polymerase chain reaction. Current recommendation of the American Academy of Pediatrics is to test individuals with intellectual disability, global developmental retardation or with a family history of presence of the mutation or premutation. Hispanic countries such as Colombia, Chile and Spain report high prevalence of fragile X syndrome and have created fragile X national associations or corporations that seek to bring patients closer to available diagnostic and treatment networks.

Autism associated with 12q (12q24. 31-q24. 33) deletion: further report of an exceedingly rare disorder / Autismo associado à síndrome de deleção do cromossomo 12q24. 31-q24. 33: relato adicional de um distúrbio extremamente raro

ABSTRACT Chromosomal abnormalities are responsible for several congenital malformations in the world, some of these are associated to telomeric/subtelomeric deletions. The abnormalities involving the telomere of chromosome 12 are rare, with few reports of deletions involving 12q24.31 region in the literature, and, to our knowledge, only four of them in the 12q24.31-q24.33 region. We report a further case of interstitial deletion of bands 12q24.31-q24.33 associated with autism spectrum disorder. A 2-year-old boy with global developmental delay associated with multiple congenital anomalies. The Human Genome CGH Microarray 60K confirmed the diagnosis of 12q deletion syndrome. This study made a review of the current literature comparing our patient with previously reported cases. These detailed analyses contribute to the development of genotype/phenotype correlations for 12q deletions that will aid in better diagnosis and prognosis of this deletion.

RESUMO Anomalias cromossômicas são responsáveis por inúmeras malformações congênitas no mundo, algumas delas associadas a deleções teloméricas/subteloméricas. As anomalias que envolvem o telômero do cromossomo 12 são raras, com poucos relatos na literatura sobre deleções relacionados à região 12q24.31 e, até onde sabemos, apenas quatro deles na região 12q24.31-q24.33. Relatamos um outro caso de deleção intersticial das bandas 12q24.31-q24.33 associada ao transtorno do espectro do autismo. Trata-se de um menino de 2 anos de idade com atraso global no desenvolvimento associado a múltiplas anomalias congênitas. A utilização do Human Genome CGH Microarray 60K confirmou o diagnóstico da síndrome de deleção 12q. Este estudo fez uma revisão da literatura atual, comparando nosso paciente com casos previamente relatados. Estas análises detalhadas contribuem para o desenvolvimento de correlações genótipo/fenótipo para deleções 12q, que ajudam aos melhores diagnóstico e prognóstico desta deleção.

Autismo: Aspectos genéticos y biológicos / Autism. Genetic and biological aspects

El autismo es un trastorno del neurodesarrollo caracterizado por compromiso en la interacción social y la comunicación, asociado a intereses restringidos y conductas estereotipadas con gran prevalencia poblacional, bases neurobiológicas y alta heredabilidad. Su etiología es heterogénea y se han reconocido numerosas bases genéticas, factores ambientales y mecanismos epigenéticos. Los avances en la genética molecular, así como los estudios epidemiológicos de grandes cohortes, han posibilitado identificar entidades médicas específicas, así como genes y factores ambientales vinculados parcial o totalmente en su patogenia. Estos conocimientos, conforme las características clínicas, permiten orientar los estudios complementarios, las conductas terapéuticas, inferir un pronóstico clínico y propiciar el asesoramiento genético familiar. En este trabajo analizamos las características clínicas de los trastornos del espectro del autismo, las entidades médicas específicas que están fuertemente relacionadas a los mismos, así como los genes reconocidos, los posibles factores ambientales y los resultados epidemiológicos que permiten el adecuado asesoramiento familiar.

Autism is a neurodevelopmental disorder characterized by commitment to social interaction and communication, associated with interests restricted and stereotyped behaviors with a high population prevalence, neurobiological bases and high heritability. Its etiology is heterogeneous, numerous genetic bases, environmental factors and epigenetic mechanisms have been recognized. Advances in molecular genetics, as well as epidemiological studies of large cohorts, have made it possible to identify specific medical entities, as well as genes and environmental factors partially or totally linked in their pathogenesis. This knowledge, according to the clinical characteristics, allows to guide the complementary studies, the therapeutic conducts, to infer a clinical prognosis and to propitiate the familiar genetic advice. In this work, the most prevalent clinical characteristics identified are described; the specific medical entities that are strongly related to autism are stated, as well as the recognized genes, the possible environmental factors and the epidemiological results that allow family counseling.

Microdeleción 16p11. 2: primeros casos reportados en Argentina / 16p11. 2 Microdeletion: first report in Argentina

La microdeleción 16p11.2 se relaciona, habitualmente, con discapacidad intelectual y trastornos del espectro autista. El rango fenotípico incluye un espectro que se extiende desde discapacidad intelectual con o sin autismo, alteraciones del aprendizaje y del lenguaje hasta fenotipos normales. El diagnóstico de la microdeleción se realiza mediante estudios genómicos capaces de identificar variación en número de copias, como la hibridación genómica comparativa en microarreglos, conocida como arrayCGH. Sin embargo, la predicción del fenotipo de un individuo basada únicamente en la localización de dicha deleción sigue siendo un desafío, ya que la existencia de un gran número de variantes en el genoma dificulta la interpretación de posibles efectos funcionales de los genes que contribuyen a dicha región. Se describen dos casos clínicos de pacientes con microdeleción heterocigota en 16p11.2 y se destacan los hallazgos fenotípicos y conductuales que dificultaron la estrategia diagnóstica. También se discuten las implicancias del diagnóstico para el asesoramiento genético familiar.

The 16p11.2 recurrent microdeletion phenotype is characterized by developmental delay, intellectual disability, and/or autism spectrum disorder. This microdeletion is associated with variable clinical outcome, the phenotypical spectrum ranges from intellectual disability and/or multiple congenital anomalies, autism, learning and speech problems, to a normal phenotype. Genomic testing that determines copy number of sequences, such as chromosomal microarray, is used to identify this microdeletion. However, the prediction of the individual phenotype of a patient based only on the location of such deletion remains a challenge, regarding the existence of many genomic variants that might hinder the interpretation of possible functional effects between most of the contributing genes to that region. We describe the clinical findings in two subjects with heterozygous microdeletions at 16p11.2, highlighting the phenotypic and behavioural findings that conditioned the diagnostic strategy. We also discuss the implications of diagnosis, in practical counselling situations.

Autism in 2016: the need for answers / Autismo em 2016: necessidade de respostas

Abstract Objective: Autism spectrum disorders are lifelong and often devastating conditions that severely affect social functioning and self-sufficiency. The etiopathogenesis is presumably multifactorial, resulting from a very complex interaction between genetic and environmental factors. The dramatic increase in autism spectrum disorder prevalence observed during the last decades has led to placing more emphasis on the role of environmental factors in the etiopathogenesis. The objective of this narrative biomedical review was to summarize and discuss the results of the most recent and relevant studies about the environmental factors hypothetically involved in autism spectrum disorder etiopathogenesis. Sources: A search was performed in PubMed (United States National Library of Medicine) about the environmental factors hypothetically involved in the non-syndromic autism spectrum disorder etiopathogenesis, including: air pollutants, pesticides and other endocrine-disrupting chemicals, electromagnetic pollution, vaccinations, and diet modifications. Summary of the findings: While the association between air pollutants, pesticides and other endocrine-disrupting chemicals, and risk for autism spectrum disorder is receiving increasing confirmation, the hypothesis of a real causal relation between them needs further data. The possible pathogenic mechanisms by which environmental factors can lead to autism spectrum disorder in genetically predisposed individuals were summarized, giving particular emphasis to the increasingly important role of epigenetics. Conclusions: Future research should investigate whether there is a significant difference in the prevalence of autism spectrum disorder among nations with high and low levels of the various types of pollution. A very important goal of the research concerning the interactions between genetic and environmental factors in autism spectrum disorder etiopathogenesis is the identification of vulnerable populations, also in view of proper prevention.

Resumo Objetivo: Os transtornos do espectro autista (TEAs) são vitalícios e normalmente são doenças devastadoras que afetam gravemente o funcionamento social e a autossuficiência. A etiopatogenia é presumivelmente multifatorial, resultante de uma interação muito complexa entre fatores genéticos e ambientais. O aumento drástico na prevalência de TEAs observado nas últimas décadas levou à maior ênfase no papel dos fatores ambientais na etiopatogenia. O objetivo desta análise da narrativa biomédica foi resumir e discutir os resultados dos estudos mais recentes e relevantes sobre os fatores ambientais hipoteticamente envolvidos na etiopatogenia dos TEAs. Fontes: Foi feita uma pesquisa na Biblioteca Nacional de Medicina dos Estados Unidos (PubMed) sobre os fatores ambientais hipoteticamente envolvidos na etiopatogenia dos TEAs não sindrômicos, inclusive poluentes atmosféricos, pesticidas e outros desreguladores endócrinos, poluição eletromagnética, vacinas e alterações na dieta. Resumo dos achados: Embora a associação entre poluentes atmosféricos, pesticidas e outros desreguladores endócrinos e o risco de TEA tenha recebido cada vez mais confirmações, a hipótese de uma relação causal real entre eles ainda precisa de mais dados. Os possíveis mecanismos patogênicos por meio dos quais os fatores ambientais podem causar TEA em indivíduos geneticamente predispostos foram resumidos, com ênfase especial no papel cada vez mais importante da epigenética. Conclusões: Futuras pesquisas devem investigar se há uma diferença significativa na prevalência de TEA entre nações com níveis altos e baixos de vários tipos de poluição. Um objetivo muito importante da pesquisa a respeito das interações entre fatores genéticos e ambientais na etiopatogenia do TEA é a identificação de populações vulneráveis, também em virtude da prevenção adequada.

Minería de Datos y Genómica / Data Mining and Genomics

El amplio acceso a computadoras de alto desempeño y dispositivos electrónicos de gran almacenamiento, entre otros, ha permitido en los últimos años la generación de cantidades masivas de datos, concepto que puede ser representado por Velocidad, Volumen y Variabilidad. La Minería de Datos es un proceso que permite descubrir patrones o asociaciones relevantes, no plenamente descubiertas en principio con los métodos tradicionales de análisis, en grandes bases de datos y generar modelos. Para ello, usa herramientas de áreas tales como Sistemas de Bases de Datos, Almacenamiento, Aprendizaje Automático, Estadística, Visualización de la Información y Computación de Alto Desempeño. En las últimas décadas, la biología molecular ha pasado del análisis de genes individuales a estudios más complejos que abarcan el genoma completo de un individuo. El desarrollo de tecnologías genómicas de alto desempeño, como los microarrays y la secuenciación de próxima generación (NGS), ha hecho posible producir de manera exponencial información, con la expansión de nuestro conocimiento de las bases genéticas de varias enfermedades. En la Medicina Genómica, el uso de la Minería de Datos para el análisis de la información genómica se está convirtiendo en una necesidad cada vez más buscada, contribuyendo así hacia una medicina personalizada tal que permite inferir modelos clínicamente relevantes y definir estrategias terapéuticas individualizadas a partir de datos moleculares de pacientes. (AU)

The availability of use of high-performance computers and large-storage electronic devices, among others, has allowed the generation of a huge masses of digital data, an idea that can be represented by velocity, volume and variety. Data mining is a process that permits to discover relevant patterns or relations, not previously seen with traditional methods of analysis, in large databases and generate models. It uses tools from Database Systems, Data Warehouse, Machine Learning, Statistics, Information Visualization and High-Performance Computing. In the last decades, molecular biology has moved from individual gene analysis to more complex studies that involve the complete genome. The development of high-throughput genomic technologies, such as microarrays and next-generation sequencing, has promoted the exponential growth of a huge amount of information, expanding our knowledge on the genetic basis of various diseases. In genomics medicine, the application of data mining techniques has become an increasingly important process that contributes towards a personalized medicine, that involves the inference of clinically relevant models and defines individualized therapeutic strategies based on the molecular data of patients. (AU)

Etiología del autismo: el continuo idiopático-sindrómico como tentativa explicativa / Etiology of autism: the idiopathic-syndromic continuum as explanatory attempt

Although already none doubt that the autism spectrum disorders (ASD) constitute a myriad of clinical syndromes, linked to neurodevelopment, there are still many questions that need be answered. Thus, researchers focus their efforts in genetic disorders that are in the origin of secondary autism, for to know more aboutprimary autism (or idiopathic), whose concrete cause is ignored. Delving into this, we review here recent findings in the research of such disorders, convinced that there is a primary-secondary autism continuum that rigorous studies in molecular genetics must show. However, there is much pathology with autistic behaviors whose etiology remains still unknown. In this line, aside from books, were selected indexed articles in MEDLINE, published from 2008 to 2015, related to advances in genetic research and diagnosis from autistic spectrum disorder. Like key words were used "autism", and the paired-words combinations of "autism and etiology", "autism and neurodevelopment" and "autism and genetics".

Aunque ya nadie duda que los trastornos del espectro autista (TEA) conformen una miríada de síndromes clínicos, vinculados al neurodesarrollo, aún existen muchos interrogantes por responder. Por ello, distintos investigadores centran sus esfuerzos en los trastornos genéticos causantes del autismo secundario, para así saber más del autismo primario (o idiopático), cuya causa concreta se ignora. Ahondando en esto, se revisan aquí hallazgos recientes obtenidos en la investigación de tales trastornos, al creer que existe un continuo entre el autismo primario y su homólogo secundario, que estudios rigurosos en genética molecular deberán evidenciar. No obstante, hay diversidad de patologías con conductas autistas cuya etiología aún se ignora. En tal línea, además de libros, se seleccionaron artículos indexados en MEDLINE, publicados entre 2008 y 2015, relacionados con avances en la investigación genética y diagnóstico del espectro autista. Como palabras claves se utilizaron "autismo", y las combinaciones "autismo y etiología", "autismo y neurodesarrollo" y "autismo y genética".

The broad autism phenotype in parents of individuals with autism: a systematic review of the literature / O fenótipo ampliado do autismo em pais de indivíduos autistas: uma revisão sistemática da literatura

The broad autism phenotype (BAP) is a milder manifestation of the defining symptoms of the syndrome in individuals without autism. This study conducted a systematic review of studies about behavioral characteristics of interpersonal relationships, communication and rigidity, as well as about three cognitive models, Theory of Mind, central coherence and executive function, in parents of individuals with autism. The indexed databases were LILACS, IBECS, Web of Science, and MEDLINE, and the studies retrieved were published between 1991 and March 2012. Parents of individuals with autism have more difficulties in interpersonal relationships and in pragmatic language use and have more rigidity traits. The inclusions of the cognitive theories in the group of BAP characteristics were inconclusive (AU)

O fenótipo ampliado do autismo (FAA) é a manifestação atenuada de características qualitativamente similares às que definem a síndrome, em indivíduos não portadores do transtorno. O objetivo deste artigo é realizar uma revisão sistemática de estudos que abordam as características comportamentais relacionadas a interação social, comunicação e rigidez, além dos modelos cognitivos Teoria da Mente (Theory of Mind, ToM), coerência central e funções executivas, em pais de indivíduos autistas. As bases de dados consultadas foram: LILACS, IBECS, Web of Science e MEDLINE; foram selecionados estudos publicados entre 1991 e março de 2012. Os resultados apontaram que os pais de indivíduos autistas possuem déficits na interação social, na linguagem pragmática e traços de rigidez. A inclusão dos modelos cognitivos do autismo no grupo de características que compõem o FAA permanece inconclusiva (AU)

La etiología de la esquizofrenia / The etiology of schizophrenia

Las investigaciones realizadas en los últimos años iniciaron una nueva era de conocimiento de los factores de riesgo de la esquizofrenia. Por otra parte, los métodos de estudio del genoma completo han revolucionado el campo del mapeado genético de la esquizofrenia. Estudios genéticos recientes sugieren que la variación genética rara y la variación genética común tienen una función importante en la arquitectura genética de la esquizofrenia, que el modelo poligénico es correcto, e indican una superposición de los factores genéticos que confieren susceptibilidad a la esquizofrenia y otros trastornos psiquiátricos, como el trastorno bipolar y el autismo (pleotropía). Los programas de resecuenciación del genoma completo permitirán una disección más profunda de la genética molecular de la enfermedad. Uno de los desafíos importantes de la psiquiatría genética es la traducción de las asociaciones estadísticas detectadas en estudios de genoma completo en una mejor comprensión fisiopatológica de la esquizofrenia.

Research conducted in recent years represents a new dawn of knowledge for the risk factors of schizophrenia, and genome-wide approaches have revolutionized the field of genetic mapping of schizophrenia. The aggregate genetic data increasingly support a combination of rare and common genetic variation in schizophrenia, a major role for polygenic inheritance, and a genetic overlap (pleiotropy) of schizophrenia and other psychiatric disorders, such as bipolar disorder and autism. A main challenge for the field is the translation of established genetic associations into a better pathophysiological understanding of schizophrenia. The current and upcoming resequencing programs - both exomes (all exons) and full genomes - and genome-wide transcriptional analyses will allow a more thorough dissection of the molecular genetics of the disorder.

Facial emotion recognition deficits in relatives of children with autism are not associated with 5HTTLPR / Prejuízos no reconhecimento de emoções faciais em parentes de primeiro grau de portadores de autismo não são associados com o polimorfismo 5HTTLPR

OBJECTIVE: A large body of evidence suggests that several aspects of face processing are impaired in autism and that this impairment might be hereditary. This study was aimed at assessing facial emotion recognition in parents of children with autism and its associations with a functional polymorphism of the serotonin transporter (5HTTLPR). METHOD: We evaluated 40 parents of children with autism and 41 healthy controls. All participants were administered the Penn Emotion Recognition Test (ER40) and were genotyped for 5HTTLPR. RESULTS: Our study showed that parents of children with autism performed worse in the facial emotion recognition test than controls. Analyses of error patterns showed that parents of children with autism over-attributed neutral to emotional faces. We found evidence that 5HTTLPR polymorphism did not influence the performance in the Penn Emotion Recognition Test, but that it may determine different error patterns. CONCLUSION: Facial emotion recognition deficits are more common in first-degree relatives of autistic patients than in the general population, suggesting that facial emotion recognition is a candidate endophenotype for autism.

OBJETIVO: Diversos estudos sugerem que o processamento de emoções faciais está prejudicado em portadores de autismo e que tal prejuízo possa ser hereditário. Nós estudamos o reconhecimento de emoções faciais em parentes de primeiro grau de portadores de autismo e suas associações com o polimorfismo funcional de transportador de serotonina (5HTTLPR). MÉTODO: Foram avaliados 40 parentes de primeiro grau de portadores de autismo e 41 controles saudáveis. Todos os participantes foram submetidos ao Teste de Reconhecimento de Emoções (ER40) da Bateria Neuropsicológica Computadorizada da Universidade da Pensilvânia (PENNCNP) e genotipados para o 5HTTLPR. RESULTADOS: Os parentes de primeiro grau de portadores de autismo apresentaram pior reconhecimento de emoções faciais comparados aos controles. A análise do padrão de erros mostrou que eles tendiam a reconhecer faces demonstrando emoções como neutras. O genótipo para o 5HTTLPR não influenciou a acurácia no Teste de Reconhecimento de Emoções, mas os homozigotos para o alelo L apresentaram padrão de erros diferente. Nossos resultados sugerem que prejuízos no reconhecimento de emoções faciais possam ser encontrados em maiores taxas em parentes de primeiro grau de autistas do que na população em geral. CONCLUSÃO: Nossos resultados sugerem que o reconhecimento de emoções faciais seja um candidato a endofenótipo no estudo do autismo.

High frequency of autistic traits in Williams-Beuren patients / Alta frequência dos traços de autismo em pacientes com síndrome de Williams-Beuren

Williams-Beuren syndrome is characterized by typical facies, supravalvular aortic stenosis, mental retardation, hyperacusis, and behavioral abnormalities with overfriendly personality and anxiety disorders. It is caused by a microdeletion of contiguous genes located in the 7q11.23 region. We studied 31 patients with the Williams-Beuren syndrome (19 men and 12 women), whose ages ranged from 9 to 26 years-old (median 14 years-old). The Williams-Beuren syndrome diagnosis was confirmed by FISH or microsatellite markers analysis in all patients. The objectives were to evaluate cognitive ability, verbal and total intelligence quotient execution, frequency of visual-spatial deficits, and autistic traits and to compare the results of molecular findings. The tests used were the WISC-III, WAIS-III, Rey Complex Figure and a scale of autistic traits. Their total intelligence quotient scores ranged from 51 to 86 (median of 63): 22 with mild mental retardation, 4 with moderate retardation, 4 classified as borderline and 1 as below average. All patients had marked visual-spatial deficit. The frequency of autistic traits was found in 13 of 31 patients (41.94%), with a predominance in males (ten men and three women). There was no correlation with the incidence of autistic traits in relation to the size of the deletion. This study reinforces the importance of the systematic assessment of cognitive function in Williams-Beuren syndrome patients, and it alerts researchers to the presence of a high frequency of autistic traits, as opposed to the overfriendly personality traits, which is typically showed by Williams-Beuren syndrome patients. These latter data are preliminary and further studies are necessary to confirm this specific finding in Williams-Beuren syndrome patients.

A síndrome de Williams-Beuren é caracterizada por fácies típicos, estenose aórtica supravalvar, retardo mental, hiperacusia e anormalidades comportamentais com personalidade amigável e distúrbios de ansiedade. É causada por microdeleção de genes contíguos localizados na região 7q11.23. Foram estudados 31 pacientes com a síndrome de Williams-Beuren (19 homens e 12 mulheres), cujas idades variaram de 9 a 26 anos (mediana de 14 anos). O diagnóstico da síndrome de Williams-Beuren foi confirmado pelo FISH (Fluorescence In Situ Hibridisation) ou por análise de marcadores microssatélites em todos os pacientes. Os objetivos foram: avaliar a capacidade cognitiva, o quociente de inteligência de execução verbal e total, a frequência de déficits visoespaciais, traços autistas; e comparar os resultados dos achados moleculares. Os testes utilizados foram: WISC-III, WAIS-III, Figuras Complexas de Rey e Escala de Traços Autísticos. Os pacientes apresentaram déficit cognitivo em todos os testes, o quociente de inteligência total variou de 51 a 86 (mediana de 63): 22 com deficiência mental leve, 4 com deficiência mental moderada; 4 limítrofes e 1 com média inferior. Os pacientes apresentaram déficit visoespacial. A frequência de traços autistas foi encontrada em 13 dos 31 pacientes (41,94%), com predomínio no sexo masculino (dez homens e três mulheres). Não foi encontrada correlação entre a presença de traços autísticos em relação ao tamanho da deleção. O presente estudo reforça a importância da avaliação sistemática da função cognitiva em pacientes com a síndrome de Williams-Beuren e alerta para a presença da alta frequência de traços autistas, que é o oposto da personalidade amigável tipicamente encontrada em pacientes com síndrome de Williams-Beuren. Estes últimos dados são preliminares e novos estudos serão necessários para confirmar este achado específico na síndrome de Williams-Beuren.

Autism and X-linked hypophosphatemia: A possible association.

We herein report the joint occurrence of an autistic disorder (AD) and X-linked hypophosphatemia. X-linked hypophosphatemia (XLH), an X-linked dominant disorder, is the most common of the inherited renal phosphate wasting disorders. Autism is a pervasive developmental disorder that occurs mainly due to genetic causes. In approximately 6-15% of cases, the autistic phenotype is a part of a broader genetic condition called syndromic autism. Therefore, reports of cases with the joint occurrence of a known genetic syndrome and a diagnosis of ASD by a child psychiatrist are relevant. A joint occurrence does not, however, mean that there is always a causal link between the genetic syndrome and the autistic behavioural phenotype. In this case, there are a number of arguments countering a causal link.

Genetic studies in children with intellectual disability and autistic spectrum of disorders.

Autism is one of the five disorders that falls under the umbrella of Pervasive Developmental Disorders (PDD) or Autism Spectrum Disorder (ASD), a category of neurological disorders characterized by “severe and pervasive impairment in several areas of development.” ASD is characterized by varying degrees of impairment in communication skills, social interaction and restricted, repetitive stereotyped patterns of behavior. The five disorders under PDD are autistic disorder, Asperger's disorder, childhood disintegrative disorder, Rett's disorder and PDD-not otherwise specified. ASD can often be reliably detected by the age of 3 years and, in some cases, as early as 18 months. The appearance of any warning signs of ASD is reason to have the child evaluated by a professional specializing in these disorders.